View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17945_high_42 (Length: 238)

Name: NF17945_high_42
Description: NF17945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17945_high_42
NF17945_high_42
[»] chr7 (1 HSPs)
chr7 (18-206)||(47916756-47916944)
[»] chr4 (1 HSPs)
chr4 (63-163)||(29920449-29920549)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 47916944 - 47916756
Alignment:
Q  18 ctttgcatctttaataactttcacaacatccaaatagcaatctctactcatcaccttagaatcacagccaggaatagcacatttagacccttttgcacca 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47916944 ctttgcatctttaataactttcacaacatccaaatagcaatctctactcatcaccttagaatcacagccaggaatagcacatttagacccttttgcacca 47916845  T
Q  118 gccatctgtggatgatttacttcagattctgtaactttatccattaaagtatgagcactggttacgcagttaaatcctccggtgaaaat 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  47916844 gccatctgtggatgatttacttcagattctgtaactttatccattaaagtatgagcactggttacgcagttaaatcctccggtgaaaat 47916756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 97; Significance: 8e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 8e-48
Query Start/End: Original strand, 63 - 163
Target Start/End: Original strand, 29920449 - 29920549
Alignment:
Q  63 actcatcaccttagaatcacagccaggaatagcacatttagacccttttgcaccagccatctgtggatgatttacttcagattctgtaactttatccatt 162  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29920449 actcatcaccttcgaatcacagccaggaatagcacatttagacccttttgcaccagccatctgtggatgatttacttcagattctgtaactttatccatt 29920548  T
Q  163 a 163  Q
    |    
T  29920549 a 29920549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University