View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17943_high_28 (Length: 244)

Name: NF17943_high_28
Description: NF17943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17943_high_28
NF17943_high_28
[»] chr5 (1 HSPs)
chr5 (17-244)||(27190976-27191203)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 17 - 244
Target Start/End: Complemental strand, 27191203 - 27190976
Alignment:
Q  17 agttgaagaaccaaagaaaacttttcctttggctcttttaattgctgttattttcacctgtgtttcttatttgattccactttttgctgttactggagct 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  27191203 agttgaagaaccaaagaaaacttttcctttggctcttttaattgctgttattttcacttgtgtttcttatttgattccactttttgctgttactggagct 27191104  T
Q  117 gtgaatgtgaatcaaagtgaatgggaaactgggtttcatgctcaagctgctgagattattgctggaaaatggttgaaaatttgggttgaaattggtgctg 216  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27191103 gtgaatgtgaatcaaagtgaatgggaaactgggtttcatgctcaagctgctgagattattgctggaaaatggttgaaaatttgggttgaaattggtgctg 27191004  T
Q  217 ttttatcagcaattgggctttttgaagc 244  Q
    ||||||||||||||||||||||||||||    
T  27191003 ttttatcagcaattgggctttttgaagc 27190976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University