View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17942_high_28 (Length: 225)

Name: NF17942_high_28
Description: NF17942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17942_high_28
NF17942_high_28
[»] chr8 (1 HSPs)
chr8 (1-211)||(41848383-41848593)


Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 41848383 - 41848593
Alignment:
Q  1 tgacaaatatgagtcagagcctattcttctatcaaccattccagaacttcctgattttgagattgccggactttcaccggatatcagtaacttcgtcaga 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41848383 tgacaaatatgagtcagaacctattcttctatcaaccattccagaacttcctgattttgagattgccggactttcaccggatatcagtaacttcgtcaga 41848482  T
Q  101 aagtcatcttctgagagatttacggcgccagctaatattggtatttcgtgtgcttgagggtagtctttaattacatgatggtgatataatattaacatat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  41848483 aagtcatcttctgagagatttacggcgccagctaatattggtatttcgtgtgcttgagggtagtctttaattacatgatggtgatataatattaacatat 41848582  T
Q  201 aacaatatcaa 211  Q
    |||||||||||    
T  41848583 aacaatatcaa 41848593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University