View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17933_high_15 (Length: 281)

Name: NF17933_high_15
Description: NF17933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17933_high_15
NF17933_high_15
[»] chr8 (1 HSPs)
chr8 (108-280)||(2939538-2939711)


Alignment Details
Target: chr8 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 108 - 280
Target Start/End: Complemental strand, 2939711 - 2939538
Alignment:
Q  108 caccgcttgaatttaaccaagaaaaa-tgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat 206  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2939711 caccgcttgaatttaaccaagaaaaaatgacagtagtaacttccttaaattgtgcctcaaattaaaactaacttccatacataactcatttttgaggcat 2939612  T
Q  207 cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaaccgccgatattgg 280  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2939611 cgattattaaatggcaacaaatcacaaaaaacagcagcattagagggactgaattacagaaccgccgatattgg 2939538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University