View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17930_high_10 (Length: 204)

Name: NF17930_high_10
Description: NF17930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17930_high_10
NF17930_high_10
[»] chr5 (1 HSPs)
chr5 (17-192)||(8684190-8684365)


Alignment Details
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 8684365 - 8684190
Alignment:
Q  17 atttccttaaccatgttcaccttcatgttcaaagaataaagttcagtagaaaaataattattctttgttggcatttatgtaaataatcatcagttaagga 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8684365 atttccttaaccatgttcaccttcatgttcaaagaataaagttcagtagaaaaataattattctttgttggcatttatgtaaataatcatcagttaagga 8684266  T
Q  117 aactatcatgcaacttaaacataccatggagcggtggtaaggattccagcgcgatcagttcggcaactggtctgtg 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8684265 aactatcatgcaacttaaacataccatggagcggtggtaaggattccagcgcgatcagttcggcaactggtctgtg 8684190  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University