View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17925_low_2 (Length: 246)

Name: NF17925_low_2
Description: NF17925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17925_low_2
NF17925_low_2
[»] chr5 (1 HSPs)
chr5 (23-232)||(5923412-5923621)


Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 23 - 232
Target Start/End: Complemental strand, 5923621 - 5923412
Alignment:
Q  23 agcgcgatccctttgatgccggtaatgaccacggctgtacctgttccgatggcggttccgatgcaacaatcgggatcggtgatgccgtttagttttagtg 122  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5923621 agcgcgatccctttgatgccggtaatgaccacggctgtacctgttccgatggcggttccgatgcaacaatcgggatcggtgatgccgtttagttttagtg 5923522  T
Q  123 cggagttgttgagtgtgatgcaggagatgattagaacagaggtgagaagttacatggcgggattggagcaacagaatgggatgtgttttcaaaaagctga 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5923521 cggagttgttgagtgtgatgcaggagatgattagaacagaggtgagaagttacatggcgggattggagcaacagaatgggatgtgttttcaaaaagctga 5923422  T
Q  223 ggatggaatt 232  Q
    ||||||||||    
T  5923421 ggatggaatt 5923412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University