View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17923_high_12 (Length: 213)

Name: NF17923_high_12
Description: NF17923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17923_high_12
NF17923_high_12
[»] chr4 (2 HSPs)
chr4 (18-82)||(3847089-3847153)
chr4 (144-181)||(3846989-3847026)


Alignment Details
Target: chr4 (Bit Score: 65; Significance: 9e-29; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 18 - 82
Target Start/End: Complemental strand, 3847153 - 3847089
Alignment:
Q  18 atcatgagaaaagaaactatccattctaacaaaataagttagttttacagattattagtaccatt 82  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3847153 atcatgagaaaagaaactatccattctaacaaaataagttagttttacagattattagtaccatt 3847089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 144 - 181
Target Start/End: Complemental strand, 3847026 - 3846989
Alignment:
Q  144 agtaccattaacacacattttaaactcttttactatgt 181  Q
    ||||||||||||||||||||||||||||||||||||||    
T  3847026 agtaccattaacacacattttaaactcttttactatgt 3846989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University