View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17922_low_12 (Length: 243)

Name: NF17922_low_12
Description: NF17922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17922_low_12
NF17922_low_12
[»] chr1 (1 HSPs)
chr1 (11-223)||(40001323-40001535)


Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 40001323 - 40001535
Alignment:
Q  11 aagaatatggcaaagaaaatatggattgagtgaggctgagataatgtcagctaggtaagggaagttaaacaagtaatgaaggttaaattatgatgaatgg 110  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40001323 aagaaaatggcaaagaaaatatggattgagtgaggctgagataatgtcagctaggtaagggaagttaaacaagtaatgaaggttaaattatgatgaatgg 40001422  T
Q  111 aagaagttttgatcttttaaagacaatgacttgatcatggagagaagatattggaagaccatcctctcctttctacccacttttaaaatctttcttattt 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40001423 aagaagttttgatcttttaaagacaatgacttgatcatggagagaagatattggaagaccatcctctcctttctacccacttttaaaatctttcttattt 40001522  T
Q  211 ctacgaaatccat 223  Q
    |||||||||||||    
T  40001523 ctacgaaatccat 40001535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University