View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17916_low_10 (Length: 269)

Name: NF17916_low_10
Description: NF17916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17916_low_10
NF17916_low_10
[»] chr7 (2 HSPs)
chr7 (13-90)||(8804172-8804249)
chr7 (87-229)||(8803998-8804134)
[»] chr2 (1 HSPs)
chr2 (42-82)||(29529395-29529435)


Alignment Details
Target: chr7 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 13 - 90
Target Start/End: Complemental strand, 8804249 - 8804172
Alignment:
Q  13 tcagatgacaaccaagacatctcgtggaggttttggaagatatggaatgaaggttatcaaggttcaataaagctatga 90  Q
    ||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||    
T  8804249 tcagatgacaaccaagacacctcatggaggttttggaagatatggaatgaaggttatcaaggttcaataaggctatga 8804172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 87 - 229
Target Start/End: Complemental strand, 8804134 - 8803998
Alignment:
Q  87 atgagtaagtcggatacgaaagctattcaaagaacatnnnnnnnggaagtttccgcacctaaaactcaagcctcgtgcatgggcagagagcaaagctttt 186  Q
    |||||||||||||||||  ||| ||||||||||||||       |||||||||||||||||||||||| ||||||| ||||||||||     ||||||||    
T  8804134 atgagtaagtcggatacagaagttattcaaagaacataaaaaa-ggaagtttccgcacctaaaactcaggcctcgttcatgggcaga-----aagctttt 8804041  T
Q  187 gctctctgttagctgtcatgcgccctacaggtgttgttttgaa 229  Q
    |||||||||||||||||||||||||  | ||||||||||||||    
T  8804040 gctctctgttagctgtcatgcgcccagcgggtgttgttttgaa 8803998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 42 - 82
Target Start/End: Complemental strand, 29529435 - 29529395
Alignment:
Q  42 gttttggaagatatggaatgaaggttatcaaggttcaataa 82  Q
    ||||||||||| ||| ||||||| |||||||||||||||||    
T  29529435 gttttggaagacatgaaatgaagattatcaaggttcaataa 29529395  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University