View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17915_low_30 (Length: 224)

Name: NF17915_low_30
Description: NF17915
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17915_low_30
NF17915_low_30
[»] chr2 (1 HSPs)
chr2 (28-224)||(4354327-4354523)


Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 28 - 224
Target Start/End: Original strand, 4354327 - 4354523
Alignment:
Q  28 taacacactatggatcctaaccctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcactgcacaaagcgcatgg 127  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  4354327 taacacactatggatcctaaacctgctctcaaagccttgagtgaaagttttcagtgacagtaatcatatgcttcatgccttcacttcacaaagcgcatgg 4354426  T
Q  128 agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagc 224  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4354427 agttggatcacttcttcatgtgtgaatttgtccatgttcccctcttagttaaccatgcctctatcaccaatcaaatatattcatctcaaaaacaagc 4354523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University