View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17913_low_20 (Length: 229)

Name: NF17913_low_20
Description: NF17913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17913_low_20
NF17913_low_20
[»] chr5 (1 HSPs)
chr5 (170-213)||(36039464-36039507)


Alignment Details
Target: chr5 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 170 - 213
Target Start/End: Original strand, 36039464 - 36039507
Alignment:
Q  170 tatatatatagtaatcatctagtactcttttttgttgttgaagc 213  Q
    |||||||||| |||||||||||||||||||||||||||||||||    
T  36039464 tatatatatattaatcatctagtactcttttttgttgttgaagc 36039507  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University