View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17909_low_36 (Length: 241)

Name: NF17909_low_36
Description: NF17909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17909_low_36
NF17909_low_36
[»] chr7 (2 HSPs)
chr7 (26-192)||(9248525-9248691)
chr7 (26-77)||(9244402-9244453)
[»] scaffold0653 (1 HSPs)
scaffold0653 (26-78)||(5311-5362)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 5e-77; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 5e-77
Query Start/End: Original strand, 26 - 192
Target Start/End: Original strand, 9248525 - 9248691
Alignment:
Q  26 tagaaaatgtacattggattgaattgagaaagagagaaaaatattggattgaatannnnnnnggcattgtttgttattaatttaaaattatgcactttta 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
T  9248525 tagaaaatgtacattggattgaattgagaaagagagaaaaatattggattgaatatttttttggcattgtttgttattaatttaaaattatgcactttta 9248624  T
Q  126 agccattttatatttactaaagctaaatttaagaaacatgtaaatttctgggtgccaacaaaacaca 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9248625 agccattttatatttactaaagctaaatttaagaaacatgtaaatttctgggtgccaacaaaacaca 9248691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 26 - 77
Target Start/End: Original strand, 9244402 - 9244453
Alignment:
Q  26 tagaaaatgtacattggattgaattgagaaagagagaaaaatattggattga 77  Q
    ||||||||||||||||||||||||| |||| |||| ||| ||||||||||||    
T  9244402 tagaaaatgtacattggattgaattcagaatgagaaaaagatattggattga 9244453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0653 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0653
Description:

Target: scaffold0653; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 26 - 78
Target Start/End: Complemental strand, 5362 - 5311
Alignment:
Q  26 tagaaaatgtacattggattgaattgagaaagagagaaaaatattggattgaa 78  Q
    ||||||||||||||||||||||||| |||| |||| |||| ||||||||||||    
T  5362 tagaaaatgtacattggattgaattcagaatgaga-aaaagtattggattgaa 5311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University