View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17908_low_14 (Length: 237)

Name: NF17908_low_14
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17908_low_14
NF17908_low_14
[»] chr8 (1 HSPs)
chr8 (21-221)||(10521952-10522152)


Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 221
Target Start/End: Original strand, 10521952 - 10522152
Alignment:
Q  21 cgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgattaagtaaaatattatccaaacaacaatttcttggcat 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||    
T  10521952 cgaattgtagaaacaagcgtgaaaattccaaatcaacctggatgcccttgcgtctcatttgtttaagtcaaatattatccaaacaacaatttcttggcat 10522051  T
Q  121 cacctatgggtcataacctaagttatgtgtggagcagtatttttaacgggaaaattattgtgtgtgcatgatctcgatggtgcatcgggtcaggtgcaaa 220  Q
    ||||||||||||||||||||||||||||||||||||||| ||||||||| ||| ||||||| |||||| |||||||||||||||||||||||||||||||    
T  10522052 cacctatgggtcataacctaagttatgtgtggagcagtagttttaacggaaaatttattgtatgtgcaggatctcgatggtgcatcgggtcaggtgcaaa 10522151  T
Q  221 c 221  Q
    |    
T  10522152 c 10522152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University