View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17908_high_12 (Length: 217)

Name: NF17908_high_12
Description: NF17908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17908_high_12
NF17908_high_12
[»] chr4 (1 HSPs)
chr4 (14-199)||(19546208-19546393)


Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 14 - 199
Target Start/End: Original strand, 19546208 - 19546393
Alignment:
Q  14 cataggtggttgatcaggtgctttatcatgcacaaggcgagccacattcgtagcaatatgcacagcgaaaatttgatggtggcagtggtaatgggcagca 113  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||    
T  19546208 catagatggttgatcaggtgctttatcatgcacaaggcgagccacattcgtggcaatatgcacagtgaaaatttgatggtggcagtggtaatgggcagca 19546307  T
Q  114 gccaaatgcaacatagatgcggcgatgtttaaagctcgtatnnnnnnntgttggaggaatgtggcgggtcaatttattggagcgat 199  Q
    |||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||    
T  19546308 gccaaatgcaacatagatgcggcgatgtttaaagctcgtatgggggcgtgttggaggaatgtggcgggtcaatttattggagcgat 19546393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University