View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17907_low_24 (Length: 249)

Name: NF17907_low_24
Description: NF17907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17907_low_24
NF17907_low_24
[»] chr1 (1 HSPs)
chr1 (1-207)||(27724971-27725181)


Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 1 - 207
Target Start/End: Complemental strand, 27725181 - 27724971
Alignment:
Q  1 gtacattggggtcaccctgccaacatggttagtttaataaata----ctaactgatttcagttatagaaagagcgttggttagttaagttagttaattaa 96  Q
    |||||||||||||||||||||||||||||||||| ||||||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27725181 gtacattggggtcaccctgccaacatggttagttaaataaataaatactaactgatttcagttatagaaagagcgttggttagttaagttagttaattaa 27725082  T
Q  97 cgttttctgtcacatgaattgctcttgcaggcagtggtgctgtttgctatgggtggttatggtacctatctgggttttcgcattcgttattccgatgacg 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | ||||||||| |    
T  27725081 cgttttctgtcacatgaattgctcttgcaggcagtggtgctgtttgctatgggtggttacggtacctatctgggttttcgcattcgattttccgatgatg 27724982  T
Q  197 tagtaagctat 207  Q
    | ||| |||||    
T  27724981 tggtacgctat 27724971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University