View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17903_low_79 (Length: 252)

Name: NF17903_low_79
Description: NF17903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17903_low_79
NF17903_low_79
[»] chr3 (1 HSPs)
chr3 (39-241)||(53721861-53722066)


Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 39 - 241
Target Start/End: Complemental strand, 53722066 - 53721861
Alignment:
Q  39 aagagggagggaattaatgacacccacctccgtctgtcttatttattcccaaatccccgtcagtcacatcttaaatagagctggctggctgcatatgcct 138  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53722066 aagagggagggaattaatgacacccacctccgtctgtcttatttattcccaaatccccgtcagtcacatcttaaatagagctggctggctgcatatgcct 53721967  T
Q  139 ttaccctaacacctattcccatggcactagcag---tattaatcgccaaaacctatcaaatctcataatcttcgatcctttcttgatctctcaagtttca 235  Q
    ||||||||||||||||||| |||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53721966 ttaccctaacacctattcctatggcactagcagtaatattaatcgccaaaacctatcaaatctcataatcttcgatcctttcttgatctctcaagtttca 53721867  T
Q  236 tctcac 241  Q
    | ||||    
T  53721866 tttcac 53721861  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University