View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17902_high_2 (Length: 528)

Name: NF17902_high_2
Description: NF17902
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17902_high_2
NF17902_high_2
[»] chr4 (1 HSPs)
chr4 (479-518)||(1193790-1193829)
[»] chr3 (1 HSPs)
chr3 (96-138)||(45635099-45635141)


Alignment Details
Target: chr4 (Bit Score: 36; Significance: 0.00000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 479 - 518
Target Start/End: Original strand, 1193790 - 1193829
Alignment:
Q  479 tagtaatctaagaaatcttgcattatcctgtttctattgt 518  Q
    ||||||||||||||||||||||||||||||||||| ||||    
T  1193790 tagtaatctaagaaatcttgcattatcctgtttcttttgt 1193829  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 96 - 138
Target Start/End: Complemental strand, 45635141 - 45635099
Alignment:
Q  96 gcttctttttaaccatcaacatggcactgccaactcttgcaac 138  Q
    ||||||||||| | |||||||||||||||||||| ||||||||    
T  45635141 gcttctttttagcaatcaacatggcactgccaacccttgcaac 45635099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University