View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17901_high_48 (Length: 244)

Name: NF17901_high_48
Description: NF17901
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17901_high_48
NF17901_high_48
[»] chr2 (1 HSPs)
chr2 (16-138)||(32605508-32605630)
[»] chr6 (3 HSPs)
chr6 (176-244)||(5849662-5849729)
chr6 (176-244)||(5843626-5843693)
chr6 (21-90)||(6090134-6090203)


Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 16 - 138
Target Start/End: Complemental strand, 32605630 - 32605508
Alignment:
Q  16 atcacttgataatcttgtaaaaaacatagcacaaacacatagttgtctagttttggtcatttgacatggttcaaggtcttgctggaatgactctaaaatg 115  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32605630 atcacttgataatcttgtaaaaaacatagcagaaacacatagttgtctagttttggtcatttgacatggttcaaggtcttgctggaatgactctaaaatg 32605531  T
Q  116 actcataaacaccaataaaaaca 138  Q
    |||||||||||||||||||||||    
T  32605530 actcataaacaccaataaaaaca 32605508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 57; Significance: 6e-24; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 5849729 - 5849662
Alignment:
Q  176 atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagctt 244  Q
    |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  5849729 atgcatttcttaaccaac-ccatgactcagcacatggtgactcatagcagagatattatctagaagctt 5849662  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 176 - 244
Target Start/End: Complemental strand, 5843693 - 5843626
Alignment:
Q  176 atgcatttcttaaccaacaccatgactcagcatatggtgactcatagcagagatattatctagaagctt 244  Q
    |||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  5843693 atgcatttcttaaccagc-ccatgactcagcacatggtgactcatagcagagatattatctagaagctt 5843626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 21 - 90
Target Start/End: Complemental strand, 6090203 - 6090134
Alignment:
Q  21 ttgataatcttgtaaaaaacatagcacaaacacatagttgtctagttttggtcatttgacatggttcaag 90  Q
    |||||||||| |||||||  ||||||||| || ||||||||||||||| ||| | |||||||| ||||||    
T  6090203 ttgataatctcgtaaaaagtatagcacaaccatatagttgtctagtttaggtgaattgacatgtttcaag 6090134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University