View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17897_low_92 (Length: 201)

Name: NF17897_low_92
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17897_low_92
NF17897_low_92
[»] chr6 (2 HSPs)
chr6 (63-187)||(24900425-24900549)
chr6 (17-47)||(24900569-24900599)


Alignment Details
Target: chr6 (Bit Score: 125; Significance: 1e-64; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 125; E-Value: 1e-64
Query Start/End: Original strand, 63 - 187
Target Start/End: Complemental strand, 24900549 - 24900425
Alignment:
Q  63 ttgctatatctgggatcccgtagacgaataacacagtcattgaatgcaacaaactctcacctatgttaattaatttgtaatttcagcaattaatgcccgc 162  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  24900549 ttgctatatctgggatcccgtagacgaataacacagtcattgaatgcaacaaactctcacctatgttaattaatttgtaatttcagcaattaatgcccgc 24900450  T
Q  163 aacattcgattacaattgatatatg 187  Q
    |||||||||||||||||||||||||    
T  24900449 aacattcgattacaattgatatatg 24900425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 17 - 47
Target Start/End: Complemental strand, 24900599 - 24900569
Alignment:
Q  17 taggctttttgaattgacaagagactttatt 47  Q
    |||||||||||||||||||||||||||||||    
T  24900599 taggctttttgaattgacaagagactttatt 24900569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University