View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17897_low_85 (Length: 218)

Name: NF17897_low_85
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17897_low_85
NF17897_low_85
[»] chr2 (2 HSPs)
chr2 (29-202)||(2044893-2045056)
chr2 (38-117)||(2041651-2041730)
[»] chr4 (1 HSPs)
chr4 (71-117)||(37032702-37032748)


Alignment Details
Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 29 - 202
Target Start/End: Original strand, 2044893 - 2045056
Alignment:
Q  29 cctgcacccgcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgttgtttannnnnnncat 128  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||        |||    
T  2044893 cctgcacccgcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgtt-ttttttttattcat 2044991  T
Q  129 atgattttactctcttacgttgtatgttgttgaaaataatatagtttgttcaaatttgactacgcaatagtatt 202  Q
    |||||||||||||||       ||||||||||||||||  ||||||||||||||||||||||||||||||||||    
T  2044992 atgattttactctct-------tatgttgttgaaaata--atagtttgttcaaatttgactacgcaatagtatt 2045056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 38 - 117
Target Start/End: Original strand, 2041651 - 2041730
Alignment:
Q  38 gcacccgcacccaatgctaaaagtcttagtagcgatgcatgcgatattcactcaaaggctttcctagatgtatgttgttt 117  Q
    ||||| ||||||||| || |||||||| |||||||||||||| |||||||||||||||||||||| |||||| |||||||    
T  2041651 gcacctgcacccaatactcaaagtcttggtagcgatgcatgcaatattcactcaaaggctttccttgatgtaagttgttt 2041730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 71 - 117
Target Start/End: Complemental strand, 37032748 - 37032702
Alignment:
Q  71 gatgcatgcgatattcactcaaaggctttcctagatgtatgttgttt 117  Q
    ||||||||| ||||||| |||||||| |||| |||||||||||||||    
T  37032748 gatgcatgcaatattcattcaaaggcattccaagatgtatgttgttt 37032702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University