View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17897_high_64 (Length: 255)

Name: NF17897_high_64
Description: NF17897
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17897_high_64
NF17897_high_64
[»] chr2 (1 HSPs)
chr2 (139-255)||(14108155-14108271)


Alignment Details
Target: chr2 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 139 - 255
Target Start/End: Complemental strand, 14108271 - 14108155
Alignment:
Q  139 aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactata--atatgcttccnnnnnnnnnntctccaggacgtcacttgaat 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||          |||||||||||||||||||||    
T  14108271 aaacgtgtttatttatcatagtgtatgatttgcttcaaagcgagtatttctactataatatatgcttcc--aaaaaaaatctccaggacgtcacttgaat 14108174  T
Q  237 ttctttgttggagtttcct 255  Q
    |||||||||||||||||||    
T  14108173 ttctttgttggagtttcct 14108155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University