View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17894_low_10 (Length: 482)

Name: NF17894_low_10
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17894_low_10
NF17894_low_10
[»] chr8 (2 HSPs)
chr8 (312-435)||(29385726-29385849)
chr8 (125-198)||(29385542-29385615)
[»] chr7 (1 HSPs)
chr7 (111-167)||(17853268-17853323)
[»] chr4 (1 HSPs)
chr4 (126-167)||(42055758-42055799)


Alignment Details
Target: chr8 (Bit Score: 124; Significance: 1e-63; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 312 - 435
Target Start/End: Original strand, 29385726 - 29385849
Alignment:
Q  312 caccctggcacctttattttcctctttttgtctagcaaacatatattgctcttcatatatgtctctctttgagtaacttaaaattgtcataaaacaaaaa 411  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29385726 caccctggcacctttattttcctctttttgtctagcaaacatatattgctcttcatatatgtctctctttgagtaacttaaaattgtcataaaacaaaaa 29385825  T
Q  412 ggtgaattggaggtttagtttgag 435  Q
    ||||||||||||||||||||||||    
T  29385826 ggtgaattggaggtttagtttgag 29385849  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 125 - 198
Target Start/End: Original strand, 29385542 - 29385615
Alignment:
Q  125 tgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaattaacaatctctttctgatcactttataaac 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  29385542 tgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaattaacaatctctttctgatcactttataaac 29385615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 111 - 167
Target Start/End: Original strand, 17853268 - 17853323
Alignment:
Q  111 caaagtgaatcaattgaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaa 167  Q
    |||||||||||||||| |||||||||||||||||||||||||| | |||||||||||    
T  17853268 caaagtgaatcaattgtatcaagtgagtgaatgaaagtgcaaa-tgaattgcactaa 17853323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 126 - 167
Target Start/End: Complemental strand, 42055799 - 42055758
Alignment:
Q  126 gaatcaagtgagtgaatgaaagtgcaaagtaaattgcactaa 167  Q
    |||||||||||||||||||||||| ||||| |||||||||||    
T  42055799 gaatcaagtgagtgaatgaaagtgtaaagtgaattgcactaa 42055758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University