View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17894_high_28 (Length: 253)

Name: NF17894_high_28
Description: NF17894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17894_high_28
NF17894_high_28
[»] chr8 (2 HSPs)
chr8 (133-241)||(11396214-11396322)
chr8 (18-102)||(11396099-11396183)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 133 - 241
Target Start/End: Original strand, 11396214 - 11396322
Alignment:
Q  133 gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact 232  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11396214 gtggaaaatgtgataggaggcagaacaatgtatcgaatggattgcatgcgatgtcgcaacatcgatcacaaccgtctcagcagtcattttctcagggact 11396313  T
Q  233 ttcatctca 241  Q
    |||||||||    
T  11396314 ttcatctca 11396322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 18 - 102
Target Start/End: Original strand, 11396099 - 11396183
Alignment:
Q  18 gaatcatgtgtttcagttcaaattcaggtgcttcttttttgagtatgcggttttaggtttctgtaactggatgaatatttatgaa 102  Q
    |||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  11396099 gaatcatgtgtttcagttcaaattcacgtgcttcttttttgagtatgcagttttaggtttctgtaactggatgaatatttatgaa 11396183  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University