View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1788_high_18 (Length: 227)

Name: NF1788_high_18
Description: NF1788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1788_high_18
NF1788_high_18
[»] chr6 (2 HSPs)
chr6 (1-176)||(894663-894838)
chr6 (1-32)||(5944434-5944465)
[»] scaffold0179 (1 HSPs)
scaffold0179 (37-148)||(5526-5637)


Alignment Details
Target: chr6 (Bit Score: 164; Significance: 8e-88; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 894663 - 894838
Alignment:
Q  1 taatatgcaatatccctaccaactaaaataagttattttgcctttatttatatgtatagatgatcatacgtctgcgacacaatattcaacttaattagca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||    
T  894663 taatatgcaatatccctaccaactaaaataagttattttgcctttatttataggtacagatgatcatgcgtctgcgacacaatattcaacttaattagca 894762  T
Q  101 ccatcttcgaattaatttgttatgattgattcccccaaacaaccatctcttccttgtcttgctggctttccttctc 176  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  894763 ccatcttcgaattaatttgttatgattgattcccccaaacaaccatctcttccttgtcttgctggctttccttctc 894838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Complemental strand, 5944465 - 5944434
Alignment:
Q  1 taatatgcaatatccctaccaactaaaataag 32  Q
    ||||||||||||||||||||||||||||||||    
T  5944465 taatatgcaatatccctaccaactaaaataag 5944434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 84; Significance: 5e-40; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 37 - 148
Target Start/End: Complemental strand, 5637 - 5526
Alignment:
Q  37 tttgcctttatttatatgtatagatgatcatacgtctgcgacacaatattcaacttaattagcaccatcttcgaattaatttgttatgattgattccccc 136  Q
    |||||||||||||||| |||||||||||||| || |||||||||| |||||||||||||||| |||||||||| |||||||||||||||| |||||||||    
T  5637 tttgcctttatttataagtatagatgatcatgcggctgcgacacagtattcaacttaattaggaccatcttcgtattaatttgttatgatcgattccccc 5538  T
Q  137 aaacaaccatct 148  Q
    ||||||||||||    
T  5537 aaacaaccatct 5526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University