View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17885_low_6 (Length: 411)

Name: NF17885_low_6
Description: NF17885
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17885_low_6
NF17885_low_6
[»] chr5 (1 HSPs)
chr5 (147-392)||(15935888-15936133)


Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 147 - 392
Target Start/End: Complemental strand, 15936133 - 15935888
Alignment:
Q  147 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggnnnnnnngtttgttatatccaaaacagta 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||       ||||||||||||||||||||||    
T  15936133 ttaattattgaaaatatttgattggctgcttttaagggtgaggtgttaggttcggcttcacgtaattagggtttttttgtttgttatatccaaaacagta 15936034  T
Q  247 gggttaaatactcatactcaaatatcacgtaacctaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg 346  Q
    |||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15936033 gggttaaatactcatactaaaatatcacgtaacttaacctaacctgcctgctaaacaaacacaaacagatacaggatggcttccggctccggcaacgtcg 15935934  T
Q  347 tggacgaaaagttcgacccactcattcggcaagtggccatcagatt 392  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||    
T  15935933 tggacgaaaagttcgacccgctcattcggcaagtggccatcagatt 15935888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University