View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17880_low_5 (Length: 319)

Name: NF17880_low_5
Description: NF17880
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17880_low_5
NF17880_low_5
[»] chr2 (1 HSPs)
chr2 (78-192)||(10311885-10311999)
[»] chr8 (1 HSPs)
chr8 (77-186)||(38436224-38436333)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 78 - 192
Target Start/End: Original strand, 10311885 - 10311999
Alignment:
Q  78 atacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacctt 177  Q
    |||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| || ||||| ||||||||||||||||||||||||||||||||    
T  10311885 atacctggtcatagtacttgtcaccaatgatgacaaacatggacctatgccttgttttaacgccattctcaatgagagttctgattcgctcatccacctt 10311984  T
Q  178 cttcctcatatctct 192  Q
    |||||||||||||||    
T  10311985 cttcctcatatctct 10311999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 77 - 186
Target Start/End: Original strand, 38436224 - 38436333
Alignment:
Q  77 gatacctggtcatggtacttgtcaccaatgatgacaaacatggacatatgccttgttttgacaccattttcaatgagagttctgattcgctcatccacct 176  Q
    |||||||| ||| || | |||||||| || ||||||||||||||   |||||||| |||||| |||||||| || ||||||||||| || ||||||||||    
T  38436224 gatacctgatcacgggatttgtcaccgataatgacaaacatggatcgatgccttgatttgacgccattttcgataagagttctgatacgttcatccacct 38436323  T
Q  177 tcttcctcat 186  Q
    ||||||||||    
T  38436324 tcttcctcat 38436333  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University