View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17876_low_20 (Length: 261)

Name: NF17876_low_20
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17876_low_20
NF17876_low_20
[»] chr2 (1 HSPs)
chr2 (9-238)||(45096272-45096501)


Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 9 - 238
Target Start/End: Original strand, 45096272 - 45096501
Alignment:
Q  9 gagaagaaggagacaagaaatggcagagagattcatacaactttcggctatgatacctggcttgaagaaggttagttcctgcttcttctttaatattcta 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  45096272 gagaaaaaggagacaagaaatggcagagagattcatacaactttcggctatgatacctggcttgaagaaggttagttcctgcttcttctttaatattcta 45096371  T
Q  109 tatatgcaccattctgttttttgtagatcaaaacatggaaatactaaatatagattaaacatgaggtttattatattaactttttataatggataggatt 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  45096372 tatatgcaccattctgttttttgtagatcaaaacatggaaatactaaatatagattaaacatgaggtttattatattaactttttataatggataggttt 45096471  T
Q  209 ctttgttttatactgttttagtggatatgc 238  Q
    ||||||||||||||||||||||||||||||    
T  45096472 ctttgttttatactgttttagtggatatgc 45096501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University