View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17876_high_23 (Length: 252)

Name: NF17876_high_23
Description: NF17876
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17876_high_23
NF17876_high_23
[»] chr4 (2 HSPs)
chr4 (69-189)||(42631346-42631466)
chr4 (19-64)||(42631503-42631548)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 1e-59; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 69 - 189
Target Start/End: Complemental strand, 42631466 - 42631346
Alignment:
Q  69 taatgtccttcaaaccatcttgacaacccaactcaatcgcacattcactttagaccttttaaccacaactccgttaaaacaagagaccaaaattgttgat 168  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42631466 taatgtccttcaaaccatcttgacaacccaactcaatcacacattcactttagaccttttaaccacaactccgttaaaacaagagaccaaaattgttgat 42631367  T
Q  169 taaaacataagggatcaataa 189  Q
    |||||||||||||||||||||    
T  42631366 taaaacataagggatcaataa 42631346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 19 - 64
Target Start/End: Complemental strand, 42631548 - 42631503
Alignment:
Q  19 agaagattgacatataaccacacaattaatctaatgatgattcatt 64  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    
T  42631548 agaagattgacatataaccacacaattaatctaatgatgattcatt 42631503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University