View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17870_low_18 (Length: 202)

Name: NF17870_low_18
Description: NF17870
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17870_low_18
NF17870_low_18
[»] chr4 (1 HSPs)
chr4 (26-186)||(27322293-27322453)


Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 26 - 186
Target Start/End: Original strand, 27322293 - 27322453
Alignment:
Q  26 gaaccgaaatgtgactacctcaaaattaaaacgtaaacagtggaaatcataactcatttgcaccatgacattagtaaattgaatttaatatgagaaataa 125  Q
    ||||||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  27322293 gaaccgaaatgcgactacctcaaaattaaaacgtaaacagcgcaaatcataactcatttgcaccatgacattagtaaattgaatttaatatgagaaataa 27322392  T
Q  126 ccataccatgttttgaaatttagagttgttttgcaatttagaaaacacaccaggatgtatt 186  Q
    ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  27322393 ccataccatgttttgcaatttagagttgttttgcaatttagaaaacacaccaggatgtatt 27322453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University