View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17863_low_18 (Length: 227)

Name: NF17863_low_18
Description: NF17863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17863_low_18
NF17863_low_18
[»] chr2 (2 HSPs)
chr2 (149-223)||(2411187-2411261)
chr2 (71-157)||(2412488-2412574)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 3e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 149 - 223
Target Start/End: Complemental strand, 2411261 - 2411187
Alignment:
Q  149 atgtatctatcatacatatacattaggggtaaaacagttttccgaagataactttcaaacccttcggctatgtat 223  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  2411261 atgtatctatcatacatatacattacgggtaaaacagttttccgaagataactttcaaacccttcggctatgtat 2411187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 71 - 157
Target Start/End: Complemental strand, 2412574 - 2412488
Alignment:
Q  71 cgatcaccgctatattttgtgcctaaaaggaagataattatttcaccactctgggagataattcccgaaacttttgggatgtatcta 157  Q
    |||||||| ||||||||||||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||    
T  2412574 cgatcaccactatattttgtgcataaaaggaagataattatttcaccactctagaagataattcccgaaacttttgggatgtatcta 2412488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University