View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17862_high_20 (Length: 241)

Name: NF17862_high_20
Description: NF17862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17862_high_20
NF17862_high_20
[»] chr5 (1 HSPs)
chr5 (24-133)||(14354618-14354727)


Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 24 - 133
Target Start/End: Complemental strand, 14354727 - 14354618
Alignment:
Q  24 atacattatttagtagttatggaatgttttgattaatgcataaccgcaacctataacacgacattcgtaacagtcaaaatcgtaaaatcatacatatatg 123  Q
    |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||| ||||||||||    
T  14354727 atacattatttagtagttatggaatgttttgattaatgcataaccgtaatctataacacgacattcgtaacagtcaaaatcgtgaaatcctacatatatg 14354628  T
Q  124 tgacaacgat 133  Q
     |||||||||    
T  14354627 cgacaacgat 14354618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University