View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17861_low_59 (Length: 236)

Name: NF17861_low_59
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17861_low_59
NF17861_low_59
[»] chr7 (1 HSPs)
chr7 (1-179)||(43117454-43117632)


Alignment Details
Target: chr7 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 43117454 - 43117632
Alignment:
Q  1 caaatcagctaattttgcaactgaaacggacaaaatcaagattacaaaatgttaattagtgagcctaattcaaattgaaataaaattgagaacataatct 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
T  43117454 caaatcagctaattttgcaactgaaacggacaaaatcaagattacaaaatgttaattagtgagcctaattcaaattgaaataaaattgagaacagaatct 43117553  T
Q  101 atgaataccttgattgaggagccttgtgcaagtgggtaagactagcataaggtccaagtttctgatgttctattagcag 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43117554 atgaataccttgattgaggagccttgtgcaagtgggtaagactagcataaggtccaagtttctgatgttctattagcag 43117632  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University