View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17861_low_51 (Length: 253)

Name: NF17861_low_51
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17861_low_51
NF17861_low_51
[»] chr1 (1 HSPs)
chr1 (1-253)||(48894407-48894659)


Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 48894659 - 48894407
Alignment:
Q  1 aacaacaacaatgtcaaagatgacaagaacaaaggacaaaaacaagggctggtcaaagggcttgaagtcttcaaaaatcagcagaaatttcctgctttta 100  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48894659 aacaacaacaatgtcaaagatgacaagaacagaggacaaaaacaaggactggtcaaagggcttgaagtcttcaaaaatcagcagaaatttcctgctttta 48894560  T
Q  101 gttctgaagaggatgatgaatactacgaatatgacgaggacgaagaggaggaggatgaagagatgcggttcatcagggagagaaccaatcatcttcagat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
T  48894559 gttctgaagaggatgatgaatactacgaatatgacgaggacgaagaggaggaggatgaagagatgcggttcatcagggagagaactaatcatcttcagat 48894460  T
Q  201 gctaaagcaagcgaatgatgcaaacaatgtgaagaaaggtattatagctaaga 253  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48894459 gctaaagcaagcgaatgatgcaaacaatgtgaagaaaggtattatagctaaga 48894407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University