View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17861_high_63 (Length: 203)

Name: NF17861_high_63
Description: NF17861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17861_high_63
NF17861_high_63
[»] chr1 (1 HSPs)
chr1 (81-191)||(47321319-47321430)


Alignment Details
Target: chr1 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 81 - 191
Target Start/End: Original strand, 47321319 - 47321430
Alignment:
Q  81 ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttct-aaaattccatca 179  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||    
T  47321319 ttctccaattgttccagcttcttcgatctttctgtgtcagcttcacctgttccaactcttacagctttgaaaagcttcaatatttctaaaaaatccatca 47321418  T
Q  180 ttcttctcactc 191  Q
    ||||| ||||||    
T  47321419 ttcttttcactc 47321430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University