View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17860_low_16 (Length: 233)

Name: NF17860_low_16
Description: NF17860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17860_low_16
NF17860_low_16
[»] chr6 (1 HSPs)
chr6 (19-233)||(29008827-29009041)


Alignment Details
Target: chr6 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 29008827 - 29009041
Alignment:
Q  19 gaagcaccaccaacggtgtggttaccaccacaaacgcaacggaagagaattgaagccaagacgaccacgaacatagctttcactgcccagactggcctca 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
T  29008827 gaagcaccaccaacggtgtggttaccaccacaaacgcaacggaagagaatcgaagccaagacgaccacgaacatagctttcactgcccagactggcctca 29008926  T
Q  119 ttttcctannnnnnnnnnnnnnnnnnnnnnnncacagagttaactatagcttcgattcaaattcttcatctaattgaatgaatataacaccgtaacagtg 218  Q
    ||||||||                        |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||     
T  29008927 ttttcctacaaatcaaaccaaaaaatcaaaaacacagagttaactatagcttcgattcaaattcttcatctaatcgaatgaatacaacaccgtaacagta 29009026  T
Q  219 tcaaatgaaattgaa 233  Q
    ||||||| |||||||    
T  29009027 tcaaatgcaattgaa 29009041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University