View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17858_low_24 (Length: 201)

Name: NF17858_low_24
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17858_low_24
NF17858_low_24
[»] chr2 (1 HSPs)
chr2 (10-164)||(38515150-38515305)
[»] chr3 (1 HSPs)
chr3 (156-194)||(31871500-31871538)


Alignment Details
Target: chr2 (Bit Score: 144; Significance: 6e-76; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 144; E-Value: 6e-76
Query Start/End: Original strand, 10 - 164
Target Start/End: Complemental strand, 38515305 - 38515150
Alignment:
Q  10 tagataatactgagaggagagtatgtatatttggattgacatttccacacataaatttgtattagctaaattttgcaaatttattttgattaaaa-taaa 108  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
T  38515305 tagattatactgagaggagagtatgtatatttggattgacatttccacacataaatttgtattagctaaattttgcaaatttattttgattaaaagtaaa 38515206  T
Q  109 ttctatttttgccggatgattaaaaactagttcattgcaacttgagctgtgtttga 164  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38515205 ttctatttttgccggatgattaaaaactagttcattgcaacttgagctgtgtttga 38515150  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 156 - 194
Target Start/End: Complemental strand, 31871538 - 31871500
Alignment:
Q  156 tgtgtttgattgagtgcggagctatgaatatggaaagag 194  Q
    |||||||||||||||||||||||||||||||||||||||    
T  31871538 tgtgtttgattgagtgcggagctatgaatatggaaagag 31871500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University