View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17858_low_17 (Length: 250)

Name: NF17858_low_17
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17858_low_17
NF17858_low_17
[»] chr1 (1 HSPs)
chr1 (9-250)||(26034581-26034822)


Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 9 - 250
Target Start/End: Original strand, 26034581 - 26034822
Alignment:
Q  9 caagaatatcggcaagtttgagaacaagaaagctataacatcctcataattcggaacactggcacgtgtcaatttaaaattaacaacnnnnnnnggcatt 108  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||       ||||||    
T  26034581 caagtatatcggcaagtttgagaacaagaaagctataacatcctcataattcggaacactagcacgtgtcaatttaaaattaacaactttttttggcatt 26034680  T
Q  109 gatccttgataatgttttgattcattatttcttaatttctcttctcttttctctcccacaccattattccataacaacgttagagtaacattgcttgata 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  26034681 gatccttgataatgttttgattcattatttcttaatttctcttctcttttctctcccacaccattattccataacaacgttagagtaacattgcttgata 26034780  T
Q  209 gctatagaaggaaatatggctagctcacctgaaaactcagac 250  Q
    ||||||||||||||||||||||||||| |||| |||||||||    
T  26034781 gctatagaaggaaatatggctagctcaactgagaactcagac 26034822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University