View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17858_high_19 (Length: 244)

Name: NF17858_high_19
Description: NF17858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17858_high_19
NF17858_high_19
[»] chr7 (4 HSPs)
chr7 (1-225)||(11888352-11888572)
chr7 (65-120)||(7879718-7879773)
chr7 (65-120)||(40463956-40464011)
chr7 (65-120)||(38262196-38262251)
[»] chr4 (9 HSPs)
chr4 (66-126)||(40553931-40553991)
chr4 (65-122)||(38755906-38755963)
chr4 (65-121)||(44363129-44363185)
chr4 (65-120)||(5648338-5648393)
chr4 (65-120)||(20639658-20639713)
chr4 (69-119)||(40915912-40915962)
chr4 (65-122)||(11394932-11394989)
chr4 (65-122)||(11404659-11404716)
chr4 (67-120)||(54730334-54730387)
[»] chr6 (3 HSPs)
chr6 (65-120)||(6808475-6808530)
chr6 (65-120)||(13267805-13267860)
chr6 (65-120)||(29355855-29355910)
[»] chr8 (4 HSPs)
chr8 (65-123)||(13160781-13160839)
chr8 (65-120)||(35107311-35107366)
chr8 (66-120)||(39460994-39461048)
chr8 (65-119)||(45071344-45071398)
[»] chr2 (7 HSPs)
chr2 (65-121)||(14530400-14530456)
chr2 (65-120)||(9671259-9671314)
chr2 (65-120)||(10543780-10543835)
chr2 (65-120)||(10546243-10546298)
chr2 (62-121)||(14544143-14544202)
chr2 (65-119)||(40579750-40579804)
chr2 (65-118)||(41409942-41409995)
[»] chr1 (5 HSPs)
chr1 (65-121)||(4349741-4349797)
chr1 (65-120)||(27474383-27474438)
chr1 (65-109)||(4587574-4587618)
chr1 (65-125)||(30395721-30395781)
chr1 (65-109)||(31442400-31442444)
[»] scaffold0057 (1 HSPs)
scaffold0057 (65-120)||(46911-46966)
[»] chr5 (5 HSPs)
chr5 (65-120)||(16957394-16957449)
chr5 (65-120)||(25622540-25622595)
chr5 (69-120)||(32354211-32354262)
chr5 (65-120)||(38879663-38879718)
chr5 (65-109)||(3771419-3771463)
[»] chr3 (6 HSPs)
chr3 (65-120)||(13628790-13628845)
chr3 (65-120)||(16735542-16735597)
chr3 (65-120)||(40272812-40272867)
chr3 (65-120)||(54484793-54484848)
chr3 (65-119)||(22609867-22609921)
chr3 (65-121)||(10795422-10795478)


Alignment Details
Target: chr7 (Bit Score: 154; Significance: 8e-82; HSPs: 4)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 11888352 - 11888572
Alignment:
Q  1 ctaaggtttgta-tcttgcaccatacatatcattcatggcattttagttgattaatctaaccgtcggaccccttcccggacactgtgtgtgcgggagctt 99  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| || ||||||||| | |||| |||||| ||| |||||||    
T  11888352 ctaaggtttgtaatcttgcaccatacatatcattcatggcattttagttgattaatcgaacagtgggacccctttctggaccctgtgtatgcaggagctt 11888451  T
Q  100 cagtgcaccgacttgccctttaatttaacagtgtgaattatgttttcatgtaatatatattatttgtcagatgaatctcccatcaagccttttcccgtcc 199  Q
    |||||||| |  ||||||||||||||||     |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11888452 cagtgcactgggttgccctttaatttaa-----tgaattatgttttcatgtaatatatattatttgtcagatgaatctcccatcaagccttttcccgtcc 11888546  T
Q  200 attgatctcacatatgttgaggataa 225  Q
    ||||||||||||||||||||||||||    
T  11888547 attgatctcacatatgttgaggataa 11888572  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 7879718 - 7879773
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || |||||||||||||||||||||  |||||||||    
T  7879718 ggaccccttcccggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt 7879773  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 40463956 - 40464011
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||| ||||| ||| || |||||||||||||||||||||| |||||||||    
T  40463956 ggaccccttctcggaccctgcgtatgcgggagcttcagtgcaccgagttgcccttt 40464011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 38262251 - 38262196
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    ||||||||||||| |||||| || ||||||||||| |||||||||  |||||||||    
T  38262251 ggaccccttcccgaacactgcgtatgcgggagctttagtgcaccggattgcccttt 38262196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 9)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 66 - 126
Target Start/End: Complemental strand, 40553991 - 40553931
Alignment:
Q  66 gaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaattta 126  Q
    ||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||||||||    
T  40553991 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaattta 40553931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 65 - 122
Target Start/End: Complemental strand, 38755963 - 38755906
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa 122  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||||    
T  38755963 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa 38755906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 44363185 - 44363129
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta 121  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  ||||||||||    
T  44363185 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 44363129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 5648338 - 5648393
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||||||||||| |  |||||||||    
T  5648338 ggaccccttcccggaccctgcgtatgcgggagcttcagtgcactgggttgcccttt 5648393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 20639713 - 20639658
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  20639713 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 20639658  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 69 - 119
Target Start/End: Original strand, 40915912 - 40915962
Alignment:
Q  69 cccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt 119  Q
    |||||||||||| ||| || |||||||||||||||||||||  ||||||||    
T  40915912 cccttcccggaccctgcgtatgcgggagcttcagtgcaccggattgccctt 40915962  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 122
Target Start/End: Original strand, 11394932 - 11394989
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa 122  Q
    ||||||||| |||||| ||| || ||||||||||| |||||||||  |||||||||||    
T  11394932 ggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa 11394989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 122
Target Start/End: Original strand, 11404659 - 11404716
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaa 122  Q
    ||||||||| |||||| ||| || ||||||||||| |||||||||  |||||||||||    
T  11404659 ggacccctttccggaccctgcgtatgcgggagctttagtgcaccgggttgccctttaa 11404716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 67 - 120
Target Start/End: Original strand, 54730334 - 54730387
Alignment:
Q  67 accccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||| ||| || ||||||||||| |||||||||| || ||||||    
T  54730334 accccttcccggaccctgcgtatgcgggagctttagtgcaccgaattacccttt 54730387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 36; Significance: 0.00000000002; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 6808475 - 6808530
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| |||||| ||||||||||| |||||||||  |||||||||    
T  6808475 ggaccccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 6808530  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 13267805 - 13267860
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    ||||||||||| |||| ||| || |||||||||||||||||||||  |||||||||    
T  13267805 ggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccgggttgcccttt 13267860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 29355910 - 29355855
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  29355910 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 29355855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 4)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 65 - 123
Target Start/End: Original strand, 13160781 - 13160839
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaat 123  Q
    |||||||||||||||| ||| || ||||||||||||||||| |||  ||||||||||||    
T  13160781 ggaccccttcccggaccctgcgtatgcgggagcttcagtgcgccgggttgccctttaat 13160839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 35107366 - 35107311
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| |||||| ||||| ||||| |||||||||  |||||||||    
T  35107366 ggaccccttcccggacgctgtgtatgcggaagctttagtgcaccgggttgcccttt 35107311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 66 - 120
Target Start/End: Complemental strand, 39461048 - 39460994
Alignment:
Q  66 gaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    ||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  39461048 gaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 39460994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 45071344 - 45071398
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt 119  Q
    ||||||||||||||||  || || |||||||||||||||||||||  ||||||||    
T  45071344 ggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 45071398  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 14530400 - 14530456
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta 121  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  ||||||||||    
T  14530400 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 14530456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 9671259 - 9671314
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  9671259 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 9671314  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 10543780 - 10543835
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  10543780 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10543835  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 10546243 - 10546298
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  10546243 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 10546298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 62 - 121
Target Start/End: Original strand, 14544143 - 14544202
Alignment:
Q  62 gtcggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta 121  Q
    |||||||||||||| |||| ||| || ||||||||||| |||||||| | ||||||||||    
T  14544143 gtcggaccccttccgggaccctgcgtatgcgggagctttagtgcaccaagttgcccttta 14544202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Complemental strand, 40579804 - 40579750
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt 119  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  ||||||||    
T  40579804 ggaccccttcccggaccctgagtatgcgggagctttagtgcaccgggttgccctt 40579750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 65 - 118
Target Start/End: Original strand, 41409942 - 41409995
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccct 118  Q
    |||||||||||||||| |||  | |||||||||||||||||||||  |||||||    
T  41409942 ggaccccttcccggaccctgcatatgcgggagcttcagtgcaccgggttgccct 41409995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000001; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 4349741 - 4349797
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta 121  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  ||||||||||    
T  4349741 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttta 4349797  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 27474383 - 27474438
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  27474383 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 27474438  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Complemental strand, 4587618 - 4587574
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg 109  Q
    |||||||||||||||| |||  | |||||||||||||||||||||    
T  4587618 ggaccccttcccggaccctgcctatgcgggagcttcagtgcaccg 4587574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 125
Target Start/End: Complemental strand, 30395781 - 30395721
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctttaattt 125  Q
    |||||||||||||||| | |  | ||||||||||| |||||||||| ||||||||| ||||    
T  30395781 ggaccccttcccggaccccgcatatgcgggagctttagtgcaccgagttgcccttttattt 30395721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Complemental strand, 31442444 - 31442400
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg 109  Q
    ||||||||||||||||||||||| || ||||||||  ||||||||    
T  31442444 ggaccccttcccggacactgtgtatgtgggagctttggtgcaccg 31442400  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0057 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: scaffold0057
Description:

Target: scaffold0057; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 46911 - 46966
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  46911 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 46966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 16957394 - 16957449
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  16957394 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 16957449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 25622540 - 25622595
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  25622540 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccggattgcccttt 25622595  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 69 - 120
Target Start/End: Original strand, 32354211 - 32354262
Alignment:
Q  69 cccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||| |||||| ||||||||||| |||||||||  |||||||||    
T  32354211 cccttcccggaccctgtgtatgcgggagctttagtgcaccgggttgcccttt 32354262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 38879663 - 38879718
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  38879663 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 38879718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 109
Target Start/End: Original strand, 3771419 - 3771463
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccg 109  Q
    |||||||||||||||| |||||| || |||||||| |||||||||    
T  3771419 ggaccccttcccggactctgtgtatgtgggagctttagtgcaccg 3771463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 6)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 13628845 - 13628790
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  13628845 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 13628790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 16735542 - 16735597
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||||||| || ||||| ||||||||||||| |  |||||||||    
T  16735542 ggaccccttcccggacactgcgtatgcggtagcttcagtgcactgggttgcccttt 16735597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Complemental strand, 40272867 - 40272812
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  40272867 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 40272812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 65 - 120
Target Start/End: Original strand, 54484793 - 54484848
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttt 120  Q
    |||||||||||||||| ||| || ||||||||||| |||||||||  |||||||||    
T  54484793 ggaccccttcccggaccctgcgtatgcgggagctttagtgcaccgggttgcccttt 54484848  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 65 - 119
Target Start/End: Original strand, 22609867 - 22609921
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgccctt 119  Q
    ||||||||||||||||  || || |||||||||||||||||||||  ||||||||    
T  22609867 ggaccccttcccggaccttgcgtatgcgggagcttcagtgcaccgggttgccctt 22609921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 65 - 121
Target Start/End: Complemental strand, 10795478 - 10795422
Alignment:
Q  65 ggaccccttcccggacactgtgtgtgcgggagcttcagtgcaccgacttgcccttta 121  Q
    ||||||||||| |||| ||| || ||||||||||||||||||||   ||||||||||    
T  10795478 ggaccccttcctggaccctgcgtatgcgggagcttcagtgcaccaggttgcccttta 10795422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University