View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17856_low_14 (Length: 219)

Name: NF17856_low_14
Description: NF17856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17856_low_14
NF17856_low_14
[»] chr3 (1 HSPs)
chr3 (28-159)||(31462957-31463084)


Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 28 - 159
Target Start/End: Original strand, 31462957 - 31463084
Alignment:
Q  28 gaagaaaagttaaatgtgaaatatttgtttgcttaattcgacgggttaggtatcattaattaatatgattattgctgcaccttttnnnnnnntattgtat 127  Q
    |||||||||||||||||| |||| |||||||||| ||||||| |||||||||||    |||||||||||||||||||| ||||||       ||||||||    
T  31462957 gaagaaaagttaaatgtggaatacttgtttgcttgattcgacaggttaggtatc----attaatatgattattgctgcgccttttaaaaaaatattgtat 31463052  T
Q  128 tttatatcttattaaataattttaaatattac 159  Q
    ||||||||||||||||||||||||||||||||    
T  31463053 tttatatcttattaaataattttaaatattac 31463084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University