View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17853_high_16 (Length: 250)

Name: NF17853_high_16
Description: NF17853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17853_high_16
NF17853_high_16
[»] chr8 (1 HSPs)
chr8 (1-30)||(34130078-34130107)


Alignment Details
Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 30
Target Start/End: Complemental strand, 34130107 - 34130078
Alignment:
Q  1 tatgtgacgtggaatgctatttatatcatg 30  Q
    ||||||||||||||||||||||||||||||    
T  34130107 tatgtgacgtggaatgctatttatatcatg 34130078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University