View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1784_low_6 (Length: 232)

Name: NF1784_low_6
Description: NF1784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1784_low_6
NF1784_low_6
[»] chr4 (1 HSPs)
chr4 (13-217)||(35772971-35773175)


Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 13 - 217
Target Start/End: Complemental strand, 35773175 - 35772971
Alignment:
Q  13 attatactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaacttatggaacaaatgcaca 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35773175 attaaactataaagatcagaccattcaaaaaaggaacatagagaagatatgattagtgtcaatgttcaattatttattaaacttatggaacaaatgcaca 35773076  T
Q  113 tgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagaggaggagtttttgaagtt 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35773075 tgacatgcaaatatgtgttttgcatatacatacccttagggaattcttcttgttattatttggaggatgatcagaaggcagaggaggagtttttgaagtt 35772976  T
Q  213 gcatt 217  Q
    |||||    
T  35772975 gcatt 35772971  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University