View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17846_low_13 (Length: 266)

Name: NF17846_low_13
Description: NF17846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17846_low_13
NF17846_low_13
[»] chr1 (1 HSPs)
chr1 (154-256)||(48754210-48754312)
[»] chr4 (1 HSPs)
chr4 (163-236)||(35914347-35914421)


Alignment Details
Target: chr1 (Bit Score: 95; Significance: 1e-46; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 154 - 256
Target Start/End: Original strand, 48754210 - 48754312
Alignment:
Q  154 ggttaaggtttgacagttcatatttatgataaagctttgttaggttgctctagcagaaatttgaattatgattctcttgtttgtattaactacatatgat 253  Q
    ||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48754210 ggttaagttttgacagttcatatttatgataaggctttgttaggttgctctagcagaaatttgaattatgattctcttgtttgtattaactacatatgat 48754309  T
Q  254 gat 256  Q
    |||    
T  48754310 gat 48754312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 163 - 236
Target Start/End: Original strand, 35914347 - 35914421
Alignment:
Q  163 ttgacagttcatatttatgataaagctttgttaggttgctctagcagaaatttgaattatg-attctcttgtttg 236  Q
    ||||||||| | |||| | ||||||||||||||||||||||||||||| |||||||||||| ||||||| |||||    
T  35914347 ttgacagttaacatttcttataaagctttgttaggttgctctagcagatatttgaattatgaattctctcgtttg 35914421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University