View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17845_low_5 (Length: 214)

Name: NF17845_low_5
Description: NF17845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17845_low_5
NF17845_low_5
[»] chr7 (1 HSPs)
chr7 (1-214)||(41640855-41641068)


Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 41641068 - 41640855
Alignment:
Q  1 ttctcggtggcatcggttaaggcttcaaaggcgtgtggaccccacaacnnnnnnncaaggtcaaaggatttgtttctttcaagggttaatgtgtggaaag 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||||||||||||||||||||||||||||    
T  41641068 ttctcggtggcatcggttaaggcttcaaaggcgtgtggaccccacaactttttttcaaggtcaaaggatttgtttctttcaagggttaatgtgtggaaag 41640969  T
Q  101 aaccagcggcgacatgttgattggattcaaggttgcgaccgtgaactcgaacggtagaagagtctttgtgaaagtcacgacacgtgactttgagatgaag 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||    
T  41640968 aaccagcggcgacatgttgattggattcaaggttgcgaccgtgaacgcgaagggtagaagagtctttgtgaaagtcacgacacgtgactttgagatgaag 41640869  T
Q  201 ggtgagtttaacac 214  Q
    ||||||||||||||    
T  41640868 ggtgagtttaacac 41640855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University