View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17844_high_59 (Length: 226)

Name: NF17844_high_59
Description: NF17844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17844_high_59
NF17844_high_59
[»] chr7 (1 HSPs)
chr7 (1-177)||(25985901-25986075)


Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 25986075 - 25985901
Alignment:
Q  1 ttgcatagaactcatacgatgtgtataagacaactttttatagttgttaaaatatcatcactctttgtttaatttcgtcggtcgcctctcatccaaacat 100  Q
    |||||||||||||||  | |||| |||||||||| ||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||    
T  25986075 ttgcatagaactcat--ggtgtgcataagacaaccttttatagttgttaaaatatcatcactctttatttaatttcgtcagtcgcctctcatccaaacat 25985978  T
Q  101 gcataatgaatgtctcactaaattgannnnnnnnacttgtgagaatattttcaattaggtaatgagaaaaaagcata 177  Q
    ||||||||||||||||| | ||||||        |||||||||||||||||||||||||||||||||||||||||||    
T  25985977 gcataatgaatgtctcaatgaattgattttttttacttgtgagaatattttcaattaggtaatgagaaaaaagcata 25985901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University