View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17841_low_48 (Length: 255)

Name: NF17841_low_48
Description: NF17841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17841_low_48
NF17841_low_48
[»] chr7 (2 HSPs)
chr7 (148-224)||(37382592-37382668)
chr7 (12-83)||(37382456-37382527)


Alignment Details
Target: chr7 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 148 - 224
Target Start/End: Original strand, 37382592 - 37382668
Alignment:
Q  148 acttgtcaatgtagattaatataaatttttgttactagattagtggctgacacatgcatgaacaaacaggggggaga 224  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37382592 acttgtcaatgtagattaatataattttttgttactagattagtggctgacacatgcatgaacaaacaggggggaga 37382668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 12 - 83
Target Start/End: Original strand, 37382456 - 37382527
Alignment:
Q  12 aattctgaaagtaaagtatatatggtcctctttttagatgatatatggtcccatttattatatgtgaataca 83  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
T  37382456 aattctgaaagtaaagtatatatggtcctttttttagatgatatatggtcccatttattatatgtgaataca 37382527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University