View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1783_high_72 (Length: 252)

Name: NF1783_high_72
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1783_high_72
NF1783_high_72
[»] chr4 (1 HSPs)
chr4 (8-236)||(55076637-55076865)
[»] chr6 (1 HSPs)
chr6 (132-234)||(15125312-15125414)
[»] chr1 (1 HSPs)
chr1 (87-169)||(43665606-43665688)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 8 - 236
Target Start/End: Complemental strand, 55076865 - 55076637
Alignment:
Q  8 agcaaaggaagaaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  55076865 agcaaaggaagaaacgagagcgagaaggaatattgataagaagaaacatgttttgagattagcgcaaaagacatcgcaagctttagtttgggtgaaagga 55076766  T
Q  108 aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgac 207  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  55076765 aacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattctac 55076666  T
Q  208 ggtgatcaccggcagcaaggtcaccaagg 236  Q
    |||||||||||||||||||||||||||||    
T  55076665 ggtgatcaccggcagcaaggtcaccaagg 55076637  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 132 - 234
Target Start/End: Original strand, 15125312 - 15125414
Alignment:
Q  132 gagccggcggcataaccaaggatatttcccacggccatgaagaaagagaacatggcattgcccattctcattcgacggtgatcaccggcagcaaggtcac 231  Q
    ||||| || ||||||||||||| ||| || ||||||||||| |||||||||||  ||||||| |||||||||||||||||||||||  |||| |||||||    
T  15125312 gagccagcagcataaccaaggacattaccgacggccatgaaaaaagagaacatcccattgccaattctcattcgacggtgatcaccaccagcgaggtcac 15125411  T
Q  232 caa 234  Q
    |||    
T  15125412 caa 15125414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 87 - 169
Target Start/End: Original strand, 43665606 - 43665688
Alignment:
Q  87 gctttagtttgggtgaaaggaaacatgtgatagagtttgctgaaagagccggcggcataaccaaggatatttcccacggccat 169  Q
    ||||| |||| |||||| ||||||| |||| ||||||||||| |||  |||||||| ||||| ||||| || || ||||||||    
T  43665606 gcttttgttttggtgaacggaaacacgtgaaagagtttgctgtaagcaccggcggcgtaaccgaggatgttaccgacggccat 43665688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University