View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1783_high_107 (Length: 225)

Name: NF1783_high_107
Description: NF1783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1783_high_107
NF1783_high_107
[»] chr5 (1 HSPs)
chr5 (12-212)||(6594136-6594336)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 12 - 212
Target Start/End: Original strand, 6594136 - 6594336
Alignment:
Q  12 gagaagaattgatgagctggacttggagtgtagaacgggaataacggagatcgcttaacggtttctgtttcgttagagttttcgccattgacagtgacgg 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6594136 gagaagaattgatgagctggacttggagtgtagaacgggaataacggagatcgcttaacggtttctgtttcgttagagttttcgccattgacagtgacgg 6594235  T
Q  112 agtttgtgtgaggttcagaacttccgttaagtgtgacggagttttgttgaggaagttcagtgttgaaattgcgagaggaatgagtgagagtttttgaagt 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  6594236 agtttgtgtgaggttcagaacttccgttaagtgtgacggagttttgttgaggaagttcagtgttgaaattgcgagaggaatgagtgagattttttgaagt 6594335  T
Q  212 g 212  Q
    |    
T  6594336 g 6594336  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University