View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17838_high_22 (Length: 245)

Name: NF17838_high_22
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17838_high_22
NF17838_high_22
[»] chr8 (2 HSPs)
chr8 (105-230)||(40153874-40153999)
chr8 (10-64)||(40154034-40154088)


Alignment Details
Target: chr8 (Bit Score: 126; Significance: 4e-65; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 105 - 230
Target Start/End: Complemental strand, 40153999 - 40153874
Alignment:
Q  105 cattgatcgctctcgtcaaccaccgttgtcgtcaagtcaaaaacctccttgaccaggttcttcctttttctttttcatttcttgttctttatatgtcaca 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40153999 cattgatcgctctcgtcaaccaccgttgtcgtcaagtcaaaaacctccttgaccaggttcttcctttttctttttcatttcttgttctttatatgtcaca 40153900  T
Q  205 tgctaccatctttgttcactcatatg 230  Q
    ||||||||||||||||||||||||||    
T  40153899 tgctaccatctttgttcactcatatg 40153874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 10 - 64
Target Start/End: Complemental strand, 40154088 - 40154034
Alignment:
Q  10 gcataggaagccaatggaggaacatgaacaaactggaattactagtactactagt 64  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40154088 gcataggaagccaatggaggaacatgaacaaactggaattactagtactactagt 40154034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University