View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17838_high_1 (Length: 504)

Name: NF17838_high_1
Description: NF17838
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17838_high_1
NF17838_high_1
[»] chr7 (1 HSPs)
chr7 (13-490)||(40383908-40384385)
[»] chr1 (2 HSPs)
chr1 (60-263)||(52374995-52375198)
chr1 (403-455)||(52374803-52374855)


Alignment Details
Target: chr7 (Bit Score: 478; Significance: 0; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 478; E-Value: 0
Query Start/End: Original strand, 13 - 490
Target Start/End: Original strand, 40383908 - 40384385
Alignment:
Q  13 atgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcag 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40383908 atgattggatcgtggatgatgtctgtgccgatggagacacggcggcgttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcag 40384007  T
Q  113 cgttgcggagaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgag 212  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40384008 cgttgcggagaccgagctggtcgatgagtgcttggacacgagcttttttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgag 40384107  T
Q  213 agtttcttccacggtgagcatggggaagagaagatcgtcttgcatgacataagctgatataaccttttgaagacttgactccaaaacgtcaccgtttaga 312  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40384108 agtttcttccacggtgagcatggggaagagaagatcgtcttgcatgacataagctgatataaccttttgaagacttgactccaaaacgtcaccgtttaga 40384207  T
Q  313 gttacagtgcctttgagagactctttggaaattctgtcagcgagagcgtcgatgagagttgacttgccggagccacttgcaccaagaactgccatgattt 412  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40384208 gttacagtgcctttgagagactctttggaaattctgtcagcgagagcgtcgatgagagttgacttgccggagccacttgcaccaagaactgccatgattt 40384307  T
Q  413 caccgtctcttgcttcaccggagatatcattgaggagaatcttggtgccgtttggttttgtaatttcgggttcttcat 490  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40384308 caccgtctcttgcttcaccggagatatcattgaggagaatcttggtgccgtttggttttgtaatttcgggttcttcat 40384385  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 40; Significance: 0.0000000000002; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 60 - 263
Target Start/End: Complemental strand, 52375198 - 52374995
Alignment:
Q  60 ttctccaccggaaacaccacggtgaccttcatctccgatgacagttgaggcagcgttgcggagaccgagctggtcgatgagtgcttggacacgagctttt 159  Q
    ||||||||| || || |||||||||||||| |||||||| || |||   || ||||||||||| || || || || || |  ||||| |||||||| |||    
T  52375198 ttctccaccagagactccacggtgaccttcgtctccgataactgttttcgctgcgttgcggagtcctagttgatcaatcaaagcttgaacacgagcgttt 52375099  T
Q  160 ttctttgatttggagagagagcgagggagacgaaactcagcagagaacatgagagtttcttccacggtgagcatggggaagagaagatcgtcttgcatga 259  Q
    ||||||||||| ||||| || || || |  || || ||||| |  ||  ||||||||||||| || |||||||| || ||||| ||||| |||||||| |    
T  52375098 ttctttgattttgagagtgatcgcggtaatcggaattcagctgcaaaggtgagagtttcttcaactgtgagcattggaaagaggagatcatcttgcatca 52374999  T
Q  260 cata 263  Q
    ||||    
T  52374998 cata 52374995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 403 - 455
Target Start/End: Complemental strand, 52374855 - 52374803
Alignment:
Q  403 gccatgatttcaccgtctcttgcttcaccggagatatcattgaggagaatctt 455  Q
    |||||||| |||||||| | ||||||||||||||| || ||||| ||||||||    
T  52374855 gccatgatctcaccgtcacgtgcttcaccggagatttcgttgagcagaatctt 52374803  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University