View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF17837_low_64 (Length: 203)

Name: NF17837_low_64
Description: NF17837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF17837_low_64
NF17837_low_64
[»] chr5 (1 HSPs)
chr5 (28-193)||(41138017-41138186)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 28 - 193
Target Start/End: Original strand, 41138017 - 41138186
Alignment:
Q  28 tgttcctctccaatttgggaggtatggaataactattcttctctta----taattataatattactcttttgccttttttgattgctttgaaatgttttt 123  Q
    ||||||||||||||||||||||||||||||||||||||||||||||    || |||||||||||||||||||||||||||||||||||||||||||||||    
T  41138017 tgttcctctccaatttgggaggtatggaataactattcttctcttacttatacttataatattactcttttgccttttttgattgctttgaaatgttttt 41138116  T
Q  124 gtattggactgggttttcttctctagtactcaacttacgacttcctcttcacctcattccctttgcttct 193  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||    
T  41138117 gtattggactgggttttcttctctagtgctcaacttacgacttcctcttcacctcattcccttttcttct 41138186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University